abc

Information for abc, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 220968-221621 - CDS yaeE EG11737 putative transport system permease protein 221614-222645 - CDS abc EG11621 ATP-binding component of a transporter 222833-223408 + CDS yaeD EG11736 putative phosphatase

Reported regulatory sites for abc: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.595 222725-222746 R attga TTTAGACGTCTGGATGCCTTAA catcc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.987 222800-222817 R tcctt AATAAGGCATGTGACGCT agtat - 0 - 1.987 222782-222799 R acgct AGTATCGCATGTTTCGAC ctgca - 0 - 1.631 222647-222670 R gacta ACTTAATGACGATAATAAATAATC aatga - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back