abrB

Information for abrB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 745158-745949 + CDS nei EG13237 endonuclease VIII and DNA N-glycosylase with an AP lyase activity 745946-747037 - CDS abrB EG13310 putative transport protein 747144-748232 - CDS ybgO EG13311 orf; hypothetical protein

Reported regulatory sites for abrB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.423 747100-747120 R gccgc CGGAAAGGGCATCTCTTTCAG aaaat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back