accB

Information for accB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3402153-3402254 - CDS b3254 - orf; hypothetical protein 3403073-3403543 + CDS accB EG10275 acetylCoA carboxylase; BCCP subunit; carrier of biotin 3403554-3404903 + CDS accC EG10276 acetyl CoA carboxylase; biotin carboxylase subunit

Reported regulatory sites for accB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.000 3402686-3402707 cgtga ATTGTGCGGCTTGTTGCAAATT acacg - 0 - 3.000 3402911-3402932 tgcac AATGTCCGTCAAGTCTAACATT gacac - 0 - 2.692 3403010-3403029 atacg CTTTACAGACGGCGGTGAAA cgcct - 0 - 2.553 3402634-3402652 tcagc TTTTCACCTTACGTTATAA gaagt - 0 - 2.553 3402828-3402846 cgcag TTTTTGCGCTGCGGAAAAG gtgac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back