aceB

Information for aceB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4211859-4212788 + CDS metA EG10581 homoserine transsuccinylase 4213057-4214658 + CDS aceB EG10023 malate synthase A 4214688-4215992 + CDS aceA EG10022 isocitrate lyase

Reported regulatory sites for aceB: Genome coordinates Source Transcription factor Transcription factor annotation 4212807-4212822 DPInteract fruR transcriptional repressor of fru operon and others 4212936-4212950 DPInteract iclR repressor of aceBA operon

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.889 4212882-4212905 aggtg AATAAATTTTATTCATATTGTTAT caaca - 0 - 3.889 4212929-4212952 tttta ATTAAAATGGAAATTGTTTTTGAT tttgc iclR 15 - 3.578 4212830-4212853 cttac CTCAGGCACCTTCGGGTGCCTTTT ttatt - 0 - 3.578 4212998-4213021 aagag CACAACGATCCTTCGTTCACAGTG gggaa - 0 - 3.074 4212976-4212994 agtct TAGTTGTGCTGAACGAAAA gagca - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back