aceE

Information for aceE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 122092-122856 + CDS pdhR EG11088 transcriptional regulator for pyruvate dehydrogenase complex 123017-125680 + CDS aceE EG10024 pyruvate dehydrogenase (decarboxylase component) 125695-127587 + CDS aceF EG10025 pyruvate dehydrogenase (dihydrolipoyltransacetylase component)

Reported regulatory sites for aceE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.565 122930-122950 acgta GAACCTGTCTTATTGAGCTTT ccggc - 0 - 2.565 122957-122977 cggcg AGAGTTCAATGGGACAGGTTC cagaa - 0 - 2.436 122896-122919 gtaaa TCAAGCGCATATAAAAGCGCGGCA actaa - 0 - 2.309 122879-122894 attat CCAGAAGATGTTGTAA atcaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back