ackA

Information for ackA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2410697-2411152 - CDS b2295 EG14106 orf; hypothetical protein 2411490-2412692 + CDS ackA EG10027 acetate kinase 2412767-2414911 + CDS pta EG20173 phosphotransacetylase

Reported regulatory sites for ackA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.893 2411173-2411192 cacat ATAAAGATTCAAAAATTTGT gcaaa - 0 - 2.893 2411213-2411232 agcgg GACAACGTTCAAAACATTTT gtctt - 0 - 2.833 2411237-2411260 tgtct TCCATACCCACTATCAGGTATCCT ttagc - 0 - 2.833 2411334-2411357 gctga AAATTACGCAAAATGGCATAGACT caaga - 0 - 2.741 2411396-2411413 gcagt GCATGATGTTAATCATAA atgtc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back