acnB

Information for acnB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 129407-131260 - CDS yacH EG12315 putative membrane protein 131615-134212 + CDS acnB EG12316 aconitate hydrase B 134340-134750 + CDS yacL EG12605 orf; hypothetical protein

Reported regulatory sites for acnB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.227 131545-131563 tacaa ACTGCTGTCTCACAGGAGC gtgaa - 0 - 2.326 131340-131360 gcggt AGTTTAAATTTTGACTAATCT tggga - 0 - 2.326 131481-131501 taaac AGATTAACACCTCGTCAAAAT cctgc - 0 - 1.363 131379-131395 gaaag GTGATTATCACCATGCG aatta - 0 - 1.363 131582-131598 cctgc CGCACTATGACAATGAG agcga - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back