acpD

Information for acpD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1478933-1480225 + CDS ynbD EG13751 putative enzymes 1480279-1480884 - CDS acpD EG12695 acyl carrier protein phosphodiesterase 1481142-1484987 + CDS hrpA EG12936 helicase; ATP-dependent

Reported regulatory sites for acpD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.112 1480983-1481003 R atgcg TTGTTCAATAAATTCGAACAT aggct - 0 - 4.112 1480927-1480947 R cagga TTGTGAATAAAGTGTCAACAA gcaac - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.853 1480961-1480982 R aacat AGGCTTCGATTTATTGCGCTAT ctctg - 0 - 2.136 1481118-1481135 R agcga ATCCAGCCGCTGCTGCAA ggccg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back