acrA

Information for acrA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 480478-483627 - CDS acrB EG11704 acridine efflux pump 483650-484843 - CDS acrA EG11703 acridine efflux pump 484985-485632 + CDS acrR EG12116 acrAB operon repressor

Reported regulatory sites for acrA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 11.271 484933-484956 R agatt TACATACATTTGTGAATGTATGTA ccata - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.980 484894-484913 R taata TAAACGCAGCAATGGGTTTA ttaac - 0 - 4.854 484963-484984 R gccat ATGTTCGTGAATTTACAGGCGT tagat - 0 - 4.854 484869-484890 R tatta ACTTTTGACCATTGACCAATTT gaaat - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back