acs

Information for acs, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4282478-4282792 - CDS yjcH EG11943 orf; hypothetical protein 4282992-4284950 - CDS acs EG11448 acetyl-CoA synthetase 4285343-4286779 + CDS nrfA EG11781 periplasmic cytochrome c(552): plays a role in nitrite reduction

Reported regulatory sites for acs: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.880 4285031-4285052 R tctac TTTTGCGTGATCTGTCGCCCAA atact - 0 - 2.699 4285176-4285198 R aattg TAAGTGCATGTAAAATACCACTT tagag narP narL fnr 8 8 1 - 2.699 4284975-4284997 R cattt AACGCTTATGCCACATATTATTA acatc - 0 - 1.518 4285124-4285143 R tcaac AGCATGCATAACTGCATGTT cctca - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back