ada

Information for ada, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2306711-2307361 - CDS alkB EG10037 DNA repair system specific for alkylated DNA 2307361-2308425 - CDS ada EG10029 O6-methylguanine-DNA methyltransferase; transcription activator/repressor 2308499-2309554 - CDS yojL EG12073 orf; hypothetical protein

Reported regulatory sites for ada: Genome coordinates Source Transcription factor Transcription factor annotation 2308475-2308515 RegulonDB & DPInteract ada O6-methylguanine-DNA methyltransferase; transcription activator/repressor

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.673 2308475-2308496 R taaag CGCAAGATTGTTGGTTTTTGCG tgatg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.060 2308430-2308453 R gccta AAGGCTATCCTTAACCAGGGAGCT gatta - 0 - 0.193 2308453-2308469 R tgatg GTGACCGGGCAGCCTAA aggct - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back