add

Information for add, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1698981-1700153 + CDS malY EG10564 enzyme that may degrade or block biosynthesis of endogenous mal inducer; probably aminotrasferase 1700257-1701258 + CDS add EG10030 adenosine deaminase 1701292-1702371 - CDS b1624 EG13931 orf; hypothetical protein

Reported regulatory sites for add: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.757 1700216-1700235 ttttt ATAATGGTGCGCACTTTTAT atcca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.382 1700174-1700197 gtaaa AAATCGTTGCGCAATCGTGGATTT ttacc - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back