adhE

Information for adhE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1294191-1294421 - CDS b1240 EG11611 orf; hypothetical protein 1294669-1297344 - CDS adhE EG10031 CoA-linked acetaldehyde dehydrogenase and iron-dependent alcohol dehydrogenase; pyruvate-formate-lyase deactivase 1297821-1298468 + CDS ychE EG11342 putative channel protein

Reported regulatory sites for adhE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.418 1297468-1297488 R gttta AACTCTTTTAGTAAATCACAG tgagt - 0 - 4.418 1297366-1297386 R cgagc AGATGATTTACTAAAAAAGTT taaca - 0 - 4.142 1297592-1297609 R agcga TGCTGAAAGGTGTCAGCT ttgca - 0 - 3.344 1297345-1297364 R agttt AACATTATCAGGAGAGCATT atggc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back