adhP

Information for adhP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1550422-1550784 - CDS yddM EG13784 orf; hypothetical protein 1550852-1551892 - CDS adhP EG12622 alcohol dehydrogenase 1551996-1553720 - CDS sfcA EG10948 NAD-linked malate dehydrogenase (malic enzyme)

Reported regulatory sites for adhP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.199 1551967-1551988 R ctgcg CCCGGTAGTGAAGGCTACCGGG ctatt - 0 - 2.218 1551952-1551975 R tgaag GCTACCGGGCTATTTCCCTCTCCC ttttt - 0 - 0.046 1551901-1551923 R ggtag TGGCGAATAAATCTCATTTGCCT cacct - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back