adiA

Information for adiA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4334746-4335507 - CDS adiY EG11966 putative ARAC-type regulatory protein 4335832-4338102 - CDS adiA EG11501 biodegradative arginine decarboxylase 4338298-4339206 - CDS melR EG11230 regulator of melibiose operon

Reported regulatory sites for adiA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.273 4338199-4338215 R aacgt ATTGTTTATAAAACTAA atatt - 0 - 2.328 4338260-4338282 R agtat CAGCCAAAAAAATAGTTTAGCCG tcgat - 0 - 1.531 4338225-4338241 R gtgaa AATAATTTAAAATAATC acata - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back