adiY

Information for adiY, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4333272-4334609 - CDS yjdE EG12462 putative amino acid/amine transport protein; cryptic 4334746-4335507 - CDS adiY EG11966 putative ARAC-type regulatory protein 4335832-4338102 - CDS adiA EG11501 biodegradative arginine decarboxylase

Reported regulatory sites for adiY: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.471 4335656-4335671 R atcct GTAAAAAAATATGTAC atgag - 0 - 2.471 4335629-4335644 R aatta CTATAAAAATTTGTAC tatta - 0 - 1.898 4335714-4335734 R tgcaa ACAAAAATGTCATACTTTTTG cgcgg - 0 - 1.881 4335791-4335812 R aaggc GTAATTGTTTAAATAACATTAC gccgc - 0 - 1.881 4335740-4335761 R gtatg GCAACGTTTTCATAAAAATTGC tgcaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back