adk

Information for adk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 494344-496218 + CDS htpG EG10461 chaperone Hsp90; heat shock protein C 62.5 496399-497043 + CDS adk EG10032 adenylate kinase activity; pleiotropic effects on glycerol-3-phosphate acyltransferase activity 497279-498241 + CDS hemH EG10431 ferrochelatase: final enzyme of heme biosynthesis

Reported regulatory sites for adk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.724 496346-496369 ggtgg TATCGTTTATCGCTTTTTCAAAAA attcg - 0 - 0.557 496363-496384 ctttt TCAAAAAATTCGACACATTTTA agggg - 0 - 0.362 496295-496317 cgcca TTAACCGTTTCAGCCCCAGGTGC ctttc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back