aefA

Information for aefA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 484985-485632 + CDS acrR EG12116 acrAB operon repressor 485760-489122 + CDS aefA EG14240 putative alpha helix protein 489334-489495 - CDS ybaM EG12830 orf; hypothetical protein

Reported regulatory sites for aefA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.501 485643-485666 aatct GACTCCAGGATTTTTCCTGGACAT tttcg - 0 - 0.532 485692-485714 ttcac TGCGTCGTGATATTCTTGCGGTT tgact - 0 - 0.290 485728-485750 tcagg TCGTTCTTCAGGTTCAGAAACCT tcatt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back