aer

Information for aer, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3214420-3215043 + CDS yqjI EG12954 orf; hypothetical protein 3215197-3216717 - CDS aer EG12955 aerotaxis sensor receptor; flavoprotein 3217024-3218514 + CDS ygjG EG12718 probable ornithine aminotransferase

Reported regulatory sites for aer: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.299 3216992-3217010 R tattt AATGCTATCTGTTAACATT tgttg - 0 - 1.876 3216733-3216753 R acaag AAGTTAACAACCATATAACCT gcaca - 0 - 1.509 3216812-3216828 R gttta AATCGCAAATTGCGATC taaat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back