agaR

Information for agaR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3274978-3275442 + CDS yhaV EG12761 orf; hypothetical protein 3275497-3276306 - CDS agaR EG12762 putative DEOR-type transcriptional regulator of aga operon 3276555-3277835 + CDS agaZ EG12763 putative tagatose 6-phosphate kinase 2

Reported regulatory sites for agaR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.793 3276437-3276456 R atggt TTTCTGATCTGATTCACAAA agaaa - 0 - 1.635 3276510-3276530 R tactg CGATATTAATCTTTCGTTTTG tttca - 0 - 1.635 3276321-3276341 R caaaa CGAAATGAAACGAAAGTTTTA cgaaa - 0 - 1.212 3276454-3276477 R ataaa AATAAAACGAAAGATAATGGTTTT ctgat - 0 -

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back