agaZ

Information for agaZ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3275497-3276306 - CDS agaR EG12762 putative DEOR-type transcriptional regulator of aga operon 3276555-3277835 + CDS agaZ EG12763 putative tagatose 6-phosphate kinase 2 3277822-3278331 + CDS agaV EG12764 PTS system; cytoplasmic; N-acetylgalactosamine-specific IIB component 2 (EIIB-AGA)

Reported regulatory sites for agaZ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.869 3276436-3276457 gtttc TTTTGTGAATCAGATCAGAAAA ccatt - 0 - 1.134 3276416-3276436 gtttc AGTGACTTTCATTATGTTTCT tttgt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back