agp

Information for agp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1063259-1064515 + CDS yccE EG12196 orf; hypothetical protein 1064808-1066049 + CDS agp EG10033 periplasmic glucose-1-phosphatase 1066087-1066314 - CDS yccJ EG12703 orf; hypothetical protein

Reported regulatory sites for agp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.013 1064730-1064753 agcca TTTTGCGAACCTGTTCCCGGAAAA aagtc - 0 - 1.976 1064766-1064789 atttc TGTCACACTCTTTAGTGATTGATA acaaa - 0 - 1.863 1064747-1064767 gttcc CGGAAAAAAGTCATATTTCTG tcaca - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back