ahpC

Information for ahpC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 637050-637856 - CDS dsbG EG13535 thiol:disulfide interchange protein 638168-638731 + CDS ahpC EG11384 alkyl hydroperoxide reductase; C22 subunit; detoxification of hydroperoxides 638946-640541 + CDS ahpF EG11385 alkyl hydroperoxide reductase; F52a subunit; detoxification of hydroperoxides

Reported regulatory sites for ahpC: Genome coordinates Source Transcription factor Transcription factor annotation 638069-638110 PMID: 11443092 oxyR activator hydrogen peroxide-inducible genes 637831-637872 PMID: 11443092 oxyR activator hydrogen peroxide-inducible genes

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.902 638106-638124 aacgc ATTAGCCGAATCGGCAAAA attgg oxyR 5 - 1.433 637962-637982 gcact GAAGATACCAAAGGGTAGTTC agatt - 0 - 1.323 637903-637924 ggtgt TGTAATCCATGTCGTTGTTGCA tttgt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back