ahpF

Information for ahpF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 638168-638731 + CDS ahpC EG11384 alkyl hydroperoxide reductase; C22 subunit; detoxification of hydroperoxides 638946-640541 + CDS ahpF EG11385 alkyl hydroperoxide reductase; F52a subunit; detoxification of hydroperoxides 640662-641090 - CDS ybdQ EG12683 orf; hypothetical protein

Reported regulatory sites for ahpF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.955 638748-638768 ctttc ACGCCATAGCGGCGTTGGCGT cgccc - 0 IRU6 (21) 3.412 638869-638888 attct TCGGGTGCTGCGGCACCCGA ttttc - 0 - 3.274 638798-638814 ttgtg TAAGCTCCCGGGGATTC acagg - 0 IRU6 (17)

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back