aidB

Information for aidB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4410606-4411769 + CDS yjfC EG11812 putative synthetase/amidase 4411838-4413478 + CDS aidB EG11811 putative acyl coenzyme A dehydrogenase 4413595-4413897 - CDS yjfN EG12521 orf; hypothetical protein

Reported regulatory sites for aidB: Genome coordinates Source Transcription factor Transcription factor annotation 4411760-4411790 RegulonDB & DPInteract ada O6-methylguanine-DNA methyltransferase; transcription activator/repressor

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.516 4411781-4411798 tttag CAATCTCTTTCTGTCATG aatcc - 0 - 0.688 4411809-4411830 atggc AGTGACCATACTAATGGTGACT gccat - 0 - 0.293 4411799-4411815 tcatg AATCCATGGCAGTGACC atact - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back