ais

Information for ais, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2362574-2362999 + CDS yfaO EG13275 orf; hypothetical protein 2363038-2363640 - CDS ais EG13155 protein induced by aluminum 2363915-2365087 + CDS b2253 EG14089 putative enzyme

Reported regulatory sites for ais: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.472 2363836-2363852 R gatag AATATTAACTTAACCTT aagaa - 0 - 2.959 2363820-2363843 R ttaac TTAACCTTAAGAAACTAATATTAG acgta - 0 - 1.010 2363670-2363693 R aatgt AGCTCAATTTCACGGTAATTGTCT ggttg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back