alkA

Information for alkA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2141288-2144605 + CDS yegE EG12396 putative sensor-type protein 2144714-2145562 - CDS alkA EG11222 3-methyl-adenine DNA glycosylase II; inducible 2145633-2147048 + CDS yegD EG12200 putative heat shock protein

Reported regulatory sites for alkA: Genome coordinates Source Transcription factor Transcription factor annotation 2145603-2145639 RegulonDB & DPInteract ada O6-methylguanine-DNA methyltransferase; transcription activator/repressor

Species with an ortholog: PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.512 2145586-2145606 R cagcg TCTGAATAACGTTTATGCTGA aagcg - 0 - 1.002 2145614-2145632 R gacaa CCGGAATATGAAAGCAAAG cgcag - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back