amiA

Information for amiA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2549733-2550269 - CDS b2434 EG14168 orf; hypothetical protein 2550372-2551241 + CDS amiA EG11823 N-acetylmuramoyl-l-alanine amidase I 2551245-2552144 + CDS hemF EG12189 coproporphyrinogen III oxidase

Reported regulatory sites for amiA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.718 2550311-2550333 aaccg TCGTAACGGATTACGCGATACGA tataa - 0 - 5.674 2550278-2550300 ttgaa ATGAAAAGTAAAACAATTCTCAA cagca - 0 - 3.085 2550327-2550342 tacgc GATACGATATAACATC tggaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back