ampD

Information for ampD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 117752-118645 - CDS nadC EG11546 quinolinate phosphoribosyltransferase 118733-119284 + CDS ampD EG10041 regulates ampC 119281-120135 + CDS ampE EG10042 regulates ampC

Reported regulatory sites for ampD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.835 118677-118693 cataa GGTAGAAACATGCTACT ctgaa - 0 - 1.583 118702-118722 aaccg GGTATTAGCACCACATATAAG gagat - 0 - 1.049 118651-118674 gttaa AACTCCAGATAGCTAACGAATCAT aaggt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back