ansB

Information for ansB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3096577-3097584 - CDS yggM EG12704 putative alpha helix chain 3097701-3098747 - CDS ansB EG10046 periplasmic L-asparaginase II 3098923-3099642 - CDS yggN EG12705 orf; hypothetical protein

Reported regulatory sites for ansB: Genome coordinates Source Transcription factor Transcription factor annotation 3098851-3098872 DPInteract crp cyclic AMP receptor protein 3098801-3098822 DPInteract fnr transcriptional regulation of aerobic anaerobic respiration osmotic balance

Species with an ortholog: HI ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.660 3098810-3098826 R ttcac GTTGTAAATTGTTTAAC gtcaa fnr 13 - 1.484 3098833-3098856 R gcctc TAACTTTGTAGATCTCCAAAATAT attca crp 6 - 1.153 3098896-3098916 R cctct ATTTTAAGACGGCATAATACT ttttt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back