ansP

Information for ansP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1521331-1522392 + CDS b1452 EG13775 putative receptor 1522505-1524055 - CDS ansP EG13776 L-asparagine permease 1524271-1524888 + CDS b1454 EG13777 putative transferase

Reported regulatory sites for ansP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.898 1524069-1524092 R aagaa TAATGGTGATAACTATCATCGCCA ggatg - 0 - 1.885 1524163-1524184 R gttgt ATTAATCCCCTTCAGGATTGTA agggg - 0 - 1.885 1524089-1524110 R gatag TTTTATACCCATAAAGAATAAT ggtga - 0 - 1.697 1524235-1524257 R cacaa TCTTTTAAAGATTAAGTGTAGGA cagta - 0 - 1.697 1524125-1524147 R ttgca TCGTTTATCGATAACGGGTAGGA tgctg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back