aphA

Information for aphA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4264693-4265886 + CDS tyrB EG11040 tyrosine aminotransferase; tyrosine repressible 4266993-4267706 + CDS aphA EG11934 diadenosine tetraphosphatase 4267817-4268233 + CDS yjbQ EG11935 orf; hypothetical protein

Reported regulatory sites for aphA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.975 4266915-4266930 ggcag CTGGCGTTATGGTCAG atggt - 0 - 2.359 4266883-4266906 cacaa AAACCGCAGATAATCCTTCCTTTC cccgg - 0 - 1.978 4266958-4266981 caata AAAAGTTTCAACATACTGACTATT taggg - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back