appC

Information for appC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1035972-1036829 + CDS hyaF EG10473 nickel incorporation into hydrogenase-1 proteins 1036963-1038507 + CDS appC EG11380 probable third cytochrome oxidase; subunit I 1038519-1039655 + CDS appB EG11379 probable third cytochrome oxidase; subunit II

Reported regulatory sites for appC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.755 1036828-1036850 gacgt AAAAAGACGGTAAGTATCGCTTT cagtc - 0 - 1.311 1036887-1036909 ctctg GTCGTAGAGTTTCAGGATAAAGA gggag - 0 - 0.419 1036856-1036871 cagtc TTATGAATATCGCAAT cggcg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back