apt

Information for apt, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 490106-490483 + CDS ybaN EG12843 putative gene 58 490636-491187 + CDS apt EG10051 adenine phosphoribosyltransferase 491316-493247 + CDS dnaX EG10245 DNA polymerase III; tau and gamma subunits; DNA elongation factor III

Reported regulatory sites for apt: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.958 490488-490511 aagca CAACAATCGCAGTTGCAATTATTG cgtac - 0 - 1.813 490538-490561 cgttt TCGAGCACAGGCGCAGGCGGTCAA aggtt - 0 - 1.388 490514-490537 ttgcg TACAGCCAGTACATTCTGGCGTTT tcgag - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back