aqpZ

Information for aqpZ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 913181-914128 - CDS ybjE EG13426 putative surface protein 914575-915270 - CDS aqpZ EG13270 transmembrane water channel; aquaporin Z 915696-917354 + CDS ybjD EG13425 orf; hypothetical protein

Reported regulatory sites for aqpZ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.610 915508-915527 R atcaa ATAATTAGCATGATAAATTA ttttt - 0 - 1.610 915286-915305 R accat ATTTTTCACAGGGTCAATTT ttaat - 0 - 0.744 915476-915492 R cgcct AAAGGATTAAATCTTTT gcgtg - 0 - - 0.299 915394-915412 R aaatc AAATTTACTGGATTTATTT atctg - 0 - 0.299 915346-915364 R tttta AAATAGCCGCGCATTATTT ccgtc - 0 -

Critical MAP values: p=0.01 3.18 p=0.05 2.36 p=0.1 2.00 p=0.2 1.60

Click here to go back