araB

Information for araB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 66835-68337 - CDS araA EG10052 L-arabinose isomerase 68348-70048 - CDS araB EG10053 L-ribulokinase 70387-71265 + CDS araC EG10054 transcriptional regulator for ara operon

Reported regulatory sites for araB: Genome coordinates Source Transcription factor Transcription factor annotation 70107-70154 DPInteract araC transcriptional regulator for ara operon 70339-70357 RegulonDB araC transcriptional regulator for ara operon 70158-70179 DPInteract crp cyclic AMP receptor protein

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.738 70057-70080 R gtttc TCCATACCCGTTTTTTTGGATGGA gtgaa - 0 - 4.440 70153-70175 R attat TTGCACGGCGTCACACTTTGCTA tgcca crp araC 18 2 - 4.397 70126-70143 R atagc ATTTTTATCCATAAGATT agcgg araC 18 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back