araC

Information for araC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 68348-70048 - CDS araB EG10053 L-ribulokinase 70387-71265 + CDS araC EG10054 transcriptional regulator for ara operon 71351-72115 + CDS yabI EG11571 orf; hypothetical protein

Reported regulatory sites for araC: Genome coordinates Source Transcription factor Transcription factor annotation 70181-70228 DPInteract araC transcriptional regulator for ara operon 70158-70179 DPInteract crp cyclic AMP receptor protein

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.615 70057-70080 ttcac TCCATCCAAAAAAACGGGTATGGA gaaac - 0 - 4.232 70155-70173 gcata GCAAAGTGTGACGCCGTGC aaata crp 16 - 2.833 70174-70194 cgtgc AAATAATCAATGTGGACTTTT ctgcc crp araC 6 14 - 2.833 70341-70361 atgca ATATGGACAATTGGTTTCTTC tctga araC 17 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back