araD

Information for araD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 63429-65780 - CDS polB EG10747 DNA polymerase II 65855-66550 - CDS araD EG10055 L-ribulose-5-phosphate 4-epimerase 66835-68337 - CDS araA EG10052 L-arabinose isomerase

Reported regulatory sites for araD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.618 66721-66741 R agcgc ATCCGGCATTCAACGCCTGAT gcgac - 0 REPv6e (7) REP6d (7) 8.618 66636-66656 R agcgc ATCCGGCATTCAACGCCTGAT gcgac - 0 REPv6c (7) REP6b (7)

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.265 66750-66766 R gcgat TTTGTAGGCCGGATAAG caaag - 0 REPv6e (14) 4.265 66665-66681 R gcgat TTTGTAGGCCGGATAAG caaag - 0 REPv6c (14) 2.227 66692-66715 R gcgac GCTGGCGCGTCTTATCAGGCCTAC gcgct - 0 REP6d (24) 2.227 66607-66630 R gcgac GCTGGCGCGTCTTATCAGGCCTAC acgct - 0 REP6b (24)

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back