araG

Information for araG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1980862-1981566 - CDS araH_1 EG10059 high-affinity L-arabinose transport system; membrane protein; fragment 1 1981578-1983092 - CDS araG EG10058 ATP-binding component of high-affinity L-arabinose transport system 1983162-1984151 - CDS araF EG10057 L-arabinose-binding periplasmic protein

Reported regulatory sites for araG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.261 1983127-1983143 R ttccc CTCTGCATGATGCAGAG ggggt - 0 - -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.336 1983102-1983121 R ggggt GTGAACGACCAGTGATTCAC ggaga - 0 - - 1.192 1983147-1983163 R taagt AATTTGCCGGAAAAATT cccct - 0 - -

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back