araJ

Information for araJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 410255-410497 + CDS b0395 - orf; hypothetical protein 410521-411705 - CDS araJ EG10060 involved in either transport or processing of arabinose polymers 411831-414977 - CDS sbcC EG10927 ATP-dependent dsDNA exonuclease

Reported regulatory sites for araJ: Genome coordinates Source Transcription factor Transcription factor annotation 411785-411832 DPInteract araC transcriptional regulator for ara operon 411829-411861 PMID: 2231717 & RegulonDB crp cyclic AMP receptor protein 411707-411729 PMID: 2231717 & RegulonDB crp cyclic AMP receptor protein

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.641 411729-411748 R ttatt GGCTACGGTGATTGGTAGCC gttct crp 1 - 2.044 411744-411765 R tcctg CAAGCTATCACTTTATTGGCTA cggtg - 0 - 1.273 411794-411817 R cagga TAATGAATACAGAGGGGCGAATTA tctct araC 24 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back