arcB

Information for arcB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3347447-3348109 - CDS yhbL EG11383 sigma cross-reacting protein 27A (SCRP-27A) 3348330-3350660 - CDS arcB EG10062 aerobic respiration sensor-response protein; histidine protein kinase/phosphatase; sensor for arcA 3350756-3351685 - CDS yhcC EG12809 orf; hypothetical protein

Reported regulatory sites for arcB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.291 3350690-3350706 R actgt CAGAATTGGGTATTATT ggggc - 0 - 0.641 3350711-3350733 R cgcat TTCTCACACAATTTATAACGTAA ctgtc - 0 - 0.016 3350666-3350682 R ggcag GTTGTCGTGAAGGAATT cccta - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back