argC

Information for argC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4151275-4152426 - CDS argE EG11286 acetylornithine deacetylase 4152580-4153584 + CDS argC EG10065 N-acetyl-gamma-glutamylphosphate reductase 4153592-4154368 + CDS argB EG10064 acetylglutamate kinase

Reported regulatory sites for argC: Genome coordinates Source Transcription factor Transcription factor annotation 4152453-4152470 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination 4152474-4152491 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.478 4152451-4152468 atgat AGTATCAATATTCATGCA gtatt argR 16 - 6.478 4152472-4152489 cagta TTTATGAATAAAAATACA ctaac argR 16 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.256 4152427-4152449 ttcat TGTTGACACACCTCTGGTCATGA tagta - 0 - 0.953 4152491-4152510 tacac TAACGTTGAGCGTAATAAAA cccac argR 1 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back