argD

Information for argD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3484440-3486530 + CDS yhfK EG12906 orf; hypothetical protein 3486597-3487817 - CDS argD EG10066 acetylornithine delta-aminotransferase 3487903-3488466 - CDS pabA EG10682 p-aminobenzoate synthetase; component II

Reported regulatory sites for argD: Genome coordinates Source Transcription factor Transcription factor annotation 3487869-3487886 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination 3487848-3487865 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination

Species with an ortholog: PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.655 3487875-3487895 R tctga TTGCCATTTAGTGATTTTTTA tgcat argR 12 - 3.655 3487854-3487874 R tttta TGCATATTTTGTGGTTATAAT ttcac argR 18 - 1.777 3487830-3487846 R cacat TTGTTTATGCGTAACAG ggtga - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back