argE

Information for argE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4148026-4150677 - CDS ppc EG10756 phosphoenolpyruvate carboxylase 4151275-4152426 - CDS argE EG11286 acetylornithine deacetylase 4152580-4153584 + CDS argC EG10065 N-acetyl-gamma-glutamylphosphate reductase

Reported regulatory sites for argE: Genome coordinates Source Transcription factor Transcription factor annotation 4152453-4152470 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination 4152474-4152491 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.052 4152472-4152489 R gttag TGTATTTTTATTCATAAA tactg argR 16 - 7.052 4152451-4152468 R aatac TGCATGAATATTGATACT atcat argR 16 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.738 4152427-4152449 R tacta TCATGACCAGAGGTGTGTCAACA atgaa - 0 - 1.446 4152491-4152510 R gtggg TTTTATTACGCTCAACGTTA gtgta argR 1 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back