argG

Information for argG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3315854-3315930 - tRNA metY EG30061 Initiator methionine tRNAf2 3316278-3317621 + CDS argG EG10068 argininosuccinate synthetase 3317629-3319272 - CDS yhbX EG12793 putative alkaline phosphatase I

Reported regulatory sites for argG: Genome coordinates Source Transcription factor Transcription factor annotation 3316188-3316205 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination 3316209-3316226 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination 3316069-3316086 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination

Species with an ortholog: PA VC ST YP SP HI EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.823 3315942-3315962 acgtg GCAAATTCTACTCGTTTTGGG taaaa - 0 - 4.823 3315971-3315991 aaaat GCAAATACTGCTGGGATTTGG tgtac - 0 - 4.738 3316139-3316154 gcgca TTATTTTACAAAAAAC acact - 0 - 4.738 3316205-3316220 ctcat TTATTTTGCATAAAAA ttcag argR 13 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.902 3316089-3316111 agttc ACTTTCATTTGTTGAATACTTTT gcctt - 0 - 1.902 3316182-3316204 gataa AAGATGATTAAATGAAAACTCAT ttatt argR 17 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back