argH

Information for argH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4153592-4154368 + CDS argB EG10064 acetylglutamate kinase 4154429-4155802 + CDS argH EG11223 argininosuccinate lyase 4156069-4156986 + CDS oxyR EG10681 activator; hydrogen peroxide-inducible genes

Reported regulatory sites for argH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.005 4154392-4154415 gcagc TTTCCGGCATTGAATTTCAAAATA aggaa - 0 - 0.129 4154377-4154393 ttgtt GGCCGGAGGCGCAGCTT tccgg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back