argI

Information for argI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4472975-4474825 + CDS yjgL EG12531 orf; hypothetical protein 4474870-4475874 - CDS argI EG10069 ornithine carbamoyltransferase 1 4476036-4476452 + CDS yjgD EG12453 orf; hypothetical protein

Reported regulatory sites for argI: Genome coordinates Source Transcription factor Transcription factor annotation 4475921-4475938 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination 4475900-4475917 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.540 4475920-4475939 R cttgc AAATGAATAATCATCCATAT aaatt argR 18 - 6.540 4475899-4475918 R atata AATTGAATTTTAATTCATTG aggcg argR 18 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.697 4475995-4476014 R tgtcc TGCCGATACTCTTATTGTCA cacac - 0 - 1.120 4475961-4475981 R tgaca TTGCCTCCACCTTTGTGACAA agatt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back