argR

Information for argR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3380965-3381903 - CDS mdh EG10576 malate dehydrogenase 3382338-3382808 + CDS argR EG10070 repressor of arg regulon; cer-mediated site specific recombination 3383122-3383436 + CDS yhcN EG12820 orf; hypothetical protein

Reported regulatory sites for argR: Genome coordinates Source Transcription factor Transcription factor annotation 3382276-3382293 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination 3382296-3382313 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.138 3382149-3382172 tcaat TTGATAACAATTAATTTACTTTTA agcag - 0 - 5.138 3382278-3382301 ctgtt TGCATAAAAATTCATCTGTATGCA caata argR 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.551 3382222-3382244 aaatt TGATAAAATCCCGCTCTTTCATA acatt - 0 - 2.350 3382305-3382326 cacaa TAATGTTGTATCAACCACCATA tcggg argR 9 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back