argS

Information for argS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1957304-1957876 - CDS yecM EG13405 orf; hypothetical protein 1958086-1959819 + CDS argS EG10071 arginine tRNA synthetase 1959975-1960484 + CDS yecT EG14316 orf; hypothetical protein

Reported regulatory sites for argS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.378 1957892-1957913 tcagt AAAAGCGTTAATTTACCCTGTT gccct - 0 - 1.610 1957963-1957985 atagt GAAAACGGCAATACGCCACGCGC acgtt - 0 - 1.610 1957997-1958019 ctgac GAAAACAGCCATTTGCAGTATAC tcccg - 0 - 1.552 1958061-1958078 ttgct CGCTTCATCAATGTAAGG tattc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back