argT

Information for argT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2424026-2424808 - CDS hisJ EG12124 histidine-binding periplasmic protein of high-affinity histidine transport system 2425029-2425811 - CDS argT EG10072 lysine-; arginine-; ornithine-binding periplasmic protein 2426077-2426646 - CDS ubiX EG11044 3-octaprenyl-4-hydroxybenzoate carboxy-lyase

Reported regulatory sites for argT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.407 2426050-2426068 R cgctg TTGCCCTGTTTCAGGGCAA ttttg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.386 2425984-2426002 R ttcaa TCGAAACGCTGCGATTCAA ccgct - 0 - 3.679 2425925-2425945 R taatg CAACGTCTTATTAACATATTT aacgt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back